Skip to content

Melting temperature calculator

Primer Tm under every model at once, with the salt and concentration you actually used.

The unified parameter set most primer suppliers and design tools use. Match this one when your number has to agree with an order form.

nM

Of the primer strand. 200–500 nM is typical in PCR.

Buffer

mM
mM
mM
mM

Tris counts as half its concentration. dNTPs chelate magnesium, so they are subtracted before it is converted — which is why adding nucleotides lowers the melting temperature.

Tm

68.42°C

Length

28nt

GC

50%

ΔG 37 °C

-36kcal/mol

Every model, same sequence

  • Nearest neighbour — Allawi & SantaLucia 199768.42 °C
  • Salt-adjusted GC67.15 °C
  • Wallace rule84 °C

A spread of 16.9 °C across the three. This is why a melting temperature quoted without its model, salt and concentration cannot be reproduced.

ΔH°

-222.9kcal/mol

ΔS°

-602.5cal/mol·K

3′ GC clamp

2of 5

Secondary structure

Self-dimer · 4 bp · -2.32 kcal/mol · reaches the 3′ end

5'-CGTTCCAAAGATGTGGGCATGAGCTTAC-3'
                        ||||
3'-                  CATTCGAGTACGGGTGTAGAAACCTTGC-5'

Hairpin · 3 bp · -1.29 kcal/mol

5'-CGTTCCA
       |||  loop 6 nt
3'-CATTCGAGTACGGGT
FormulaTm = ΔH° / (ΔS° + R·ln(C_T/4)), ΔS° corrected by 0.368·(N−1)·ln[Na⁺]
ModelNearest neighbour — Allawi & SantaLucia 1997

Melting temperature is not annealing temperature. A common starting point is 3–5 °C below the lower primer Tm, but the optimum is found by gradient. The secondary structure check finds contiguous pairing, not a minimum free energy fold — it catches the ordinary mistakes and does not replace a folding program.

When to use this

Use this to estimate the melting temperature of a primer or probe, and to check the oligo is worth ordering at all. It reports every model at once because they disagree by more than ten degrees on the same sequence, and a Tm quoted without its model, salt and concentration is not reproducible.

Worked example

A 28-mer primer in an ordinary PCR buffer.

Oligo
CGTTCCAAAGATGTGGGCATGAGCTTAC
Oligo concentration
250 nM
Buffer
50 mM Na⁺, 10 mM Tris, 1.5 mM Mg²⁺, 0.8 mM dNTPs

Result

Nearest neighbour 68.4 °C

The salt-adjusted formula says 67.2 and the Wallace rule 84.0 — a 16.9 °C spread, which is why the model has to be stated.

What people get wrong

  • Using a Tm from one tool with an annealing temperature rule from another. The models disagree, so mixing sources silently shifts your annealing temperature by degrees.
  • Leaving the salt at a default. Magnesium raises the Tm substantially and dNTPs chelate it back down, so a PCR buffer is a genuinely different environment from 50 mM sodium.
  • Treating melting temperature as annealing temperature. A common starting point is 3–5 °C below the lower primer Tm, but the optimum comes from a gradient.

Questions

+Which model should I use?

Nearest neighbour, and the Allawi & SantaLucia 1997 set if your number has to agree with a supplier. The other two are shown so you can see how far a simpler rule drifts.

+Why is my supplier’s Tm different?

Almost always the parameter set, the salt, or the oligo concentration. Match all three and the numbers converge.

+What is a self-dimer and does it matter?

A primer pairing with a copy of itself. It consumes primer and can amplify, and it matters most when the pairing reaches the 3′ end, because then the primer can extend on itself.

Related tools

Science last reviewed .