Melting temperature calculator
Primer Tm under every model at once, with the salt and concentration you actually used.
The unified parameter set most primer suppliers and design tools use. Match this one when your number has to agree with an order form.
Of the primer strand. 200–500 nM is typical in PCR.
Buffer
Tris counts as half its concentration. dNTPs chelate magnesium, so they are subtracted before it is converted — which is why adding nucleotides lowers the melting temperature.
Tm
Length
GC
ΔG 37 °C
Every model, same sequence
- Nearest neighbour — Allawi & SantaLucia 199768.42 °C
- Salt-adjusted GC67.15 °C
- Wallace rule84 °C
A spread of 16.9 °C across the three. This is why a melting temperature quoted without its model, salt and concentration cannot be reproduced.
ΔH°
ΔS°
3′ GC clamp
Secondary structure
Self-dimer · 4 bp · -2.32 kcal/mol · reaches the 3′ end
5'-CGTTCCAAAGATGTGGGCATGAGCTTAC-3'
||||
3'- CATTCGAGTACGGGTGTAGAAACCTTGC-5'Hairpin · 3 bp · -1.29 kcal/mol
5'-CGTTCCA
||| loop 6 nt
3'-CATTCGAGTACGGGTTm = ΔH° / (ΔS° + R·ln(C_T/4)), ΔS° corrected by 0.368·(N−1)·ln[Na⁺]- Nearest-neighbour parameters for Watson–Crick DNA base pairs — Biochemistry, 1997
- Monovalent equivalent of magnesium and dNTPs in a PCR buffer — Clinical Chemistry, 2001
Melting temperature is not annealing temperature. A common starting point is 3–5 °C below the lower primer Tm, but the optimum is found by gradient. The secondary structure check finds contiguous pairing, not a minimum free energy fold — it catches the ordinary mistakes and does not replace a folding program.
When to use this
Use this to estimate the melting temperature of a primer or probe, and to check the oligo is worth ordering at all. It reports every model at once because they disagree by more than ten degrees on the same sequence, and a Tm quoted without its model, salt and concentration is not reproducible.
Worked example
A 28-mer primer in an ordinary PCR buffer.
- Oligo
- CGTTCCAAAGATGTGGGCATGAGCTTAC
- Oligo concentration
- 250 nM
- Buffer
- 50 mM Na⁺, 10 mM Tris, 1.5 mM Mg²⁺, 0.8 mM dNTPs
Result
The salt-adjusted formula says 67.2 and the Wallace rule 84.0 — a 16.9 °C spread, which is why the model has to be stated.
What people get wrong
- Using a Tm from one tool with an annealing temperature rule from another. The models disagree, so mixing sources silently shifts your annealing temperature by degrees.
- Leaving the salt at a default. Magnesium raises the Tm substantially and dNTPs chelate it back down, so a PCR buffer is a genuinely different environment from 50 mM sodium.
- Treating melting temperature as annealing temperature. A common starting point is 3–5 °C below the lower primer Tm, but the optimum comes from a gradient.
Questions
+Which model should I use?
Nearest neighbour, and the Allawi & SantaLucia 1997 set if your number has to agree with a supplier. The other two are shown so you can see how far a simpler rule drifts.
+Why is my supplier’s Tm different?
Almost always the parameter set, the salt, or the oligo concentration. Match all three and the numbers converge.
+What is a self-dimer and does it matter?
A primer pairing with a copy of itself. It consumes primer and can amplify, and it matters most when the pairing reaches the 3′ end, because then the primer can extend on itself.
Related tools
- Reverse complement — Generate the reverse, complement or reverse complement of a sequence.
- GC content calculator — Measure GC content and base composition of a nucleotide sequence.
- DNA translation — Translate a nucleotide sequence into protein in any reading frame.
Science last reviewed .