Skip to content

GC content calculator

Measure GC content and base composition of a nucleotide sequence.

GC content

Paste a sequence to calculate.

FormulaGC% = (G + C + S) ÷ (G + C + S + A + T + W) × 100

When to use this

Use this for the base composition of a sequence: GC percentage, counts, and GC skew. It is a quick sanity check on a primer, a read, or an assembly, and an input to older melting temperature formulas.

Worked example

Checking a 20-mer primer before ordering.

Sequence
ACGTAGCTAGGATCATGACC (20 nt)

Result

50% GC

Between 40 and 60% is the usual target for a PCR primer, so this one is comfortable.

What people get wrong

  • Comparing GC percentages between sequences of very different length. A 20-mer moves 5% per base; a 2 kb sequence does not.
  • Deciding what ambiguity codes should count as after the fact. Fix the convention first, because counting, ignoring or refusing them gives three different denominators.
  • Using GC content alone to judge a primer. It says nothing about where the G and C sit, and a 3′ end matters far more than the overall figure.

Questions

+What GC content should a primer have?

Roughly 40 to 60%. Outside that range annealing behaves less predictably, though the distribution along the primer matters more than the total.

+What is GC skew for?

It is (G − C)/(G + C) along a sequence, and it changes sign at the replication origin and terminus in many bacterial genomes.

+Does GC content predict melting temperature?

Only loosely. The salt-adjusted formula uses it, but nearest-neighbour thermodynamics accounts for sequence order and is what primer suppliers quote.

Related tools

  • Reverse complement — Generate the reverse, complement or reverse complement of a sequence.
  • DNA translation — Translate a nucleotide sequence into protein in any reading frame.

Science last reviewed .